distorted night

salve

Me and all 40 voices in my head ahhh... my computer wish you a happy new year 2014!

happy new year 2014!

the german version of this poem:
https://soundcloud.com/jpiringer/gegenwart

present

Abators abate.
Abbreviators abbreviate.
Abdicators abdicate.
Aberrators aberrate.
Ablators ablate.
Abnegators abnegate.
Abominators abominate.
Abrogators abrogate.
Accelerators accelerate.
Accentuators accentuate.
Accommodators accommodate.
Accumulators accumulate.
Acetylators acetylate.
Activators activate.
Actuators actuate.
Adjudicators adjudicate.
Administrators administrate.
Adstipulators adstipulate.
Adulators adulate.
Adulterators adulterate.
Advocators advocate.
Aerators aerate.
Agglomerators agglomerate.
Agglutinators agglutinate.
Aggravators aggravate.
Aggregators aggregate.
Agitators agitate.
Alienators alienate.
Allegators allegate.
Alleviators alleviate.
Alligators alligate.
Alliterators alliterate.
Allocators allocate.
Alternators alternate.
Amalgamators amalgamate.
Ambulators ambulate.
Ameliorators ameliorate.
Amputators amputate.
Animators animate.
Annihilators annihilate.
Annotators annotate.
Annunciators annunciate.
Anticipators anticipate.
Applicators applicate.
Appreciators appreciate.
Approbators approbate.
Appropriators appropriate.
Approximators approximate.
Arbitrators arbitrate.
Arrogators arrogate.
Articulators articulate.
Asphyxiators asphyxiate.
Aspirators aspirate.
Assassinators assassinate.
Asseverators asseverate.
Assimilators assimilate.
Associators associate.
Astrogators astrogate.
Attemperators attemperate.
Attenuators attenuate.
Auscultators auscultate.
Authenticators authenticate.
Auxiliators auxiliate.
Averruncators averruncate.
Aviators aviate.
Avigators avigate.
Brachiators brachiate.
Cachinnators cachinnate.
Calculators calculate.
Calibrators calibrate.
Calumniators calumniate.
Capitulators capitulate.
Caprificators caprificate.
Captivators captivate.
Carbonators carbonate.
Carburators carburate.
Castigators castigate.
Castrators castrate.
Celebrators celebrate.
Centuriators centuriate.
Certificators certificate.
Chlorinators chlorinate.
Circulators circulate.
Circumambulators circumambulate.
Circumaviators circumaviate.
Circumnavigators circumnavigate.
Co-ordinators co-ordinate.
Coagitators coagitate.
Coagulators coagulate.
Cocreators cocreate.
Cogitators cogitate.
Cohobators cohobate.
Collaborators collaborate.
Collators collate.
Collimators collimate.
Combinators combinate.
Commemorators commemorate.
Commentators commentate.
Comminators comminate.
Commiserators commiserate.
Communicators communicate.
Commutators commutate.
Comparators comparate.
Compensators compensate.
Concatenators concatenate.
Concentrators concentrate.
Conciliators conciliate.
Condensators condensate.
Confabulators confabulate.
Confederators confederate.
Confiscators confiscate.
Conflagrators conflagrate.
Conformators conformate.
Congratulators congratulate.
Congregators congregate.
Conjugators conjugate.
Consecrators consecrate.
Conservators conservate.
Considerators considerate.
Consignificators consignificate.
Consolidators consolidate.
Consummators consummate.
Contaminators contaminate.
Contemplators contemplate.
Continuators continuate.
Convocators convocate.
Cooperators cooperate.
Coordinators coordinate.
Corporators corporate.
Corroborators corroborate.
Corrugators corrugate.
Creators create.
Cremators cremate.
Criminators criminate.
Cultivators cultivate.
Cuneators cuneate.
Curators curate.
Deaerators deaerate.
Dearsenicators dearsenicate.
Debellators debellate.
Decapitators decapitate.
Decarbonators decarbonate.
Decators decate.
Decelerators decelerate.
Decimators decimate.
Decollators decollate.
Deconcentrators deconcentrate.
Decorators decorate.
Decorticators decorticate.
Dedicators dedicate.
Defalcators defalcate.
Defecators defecate.
Defibrillators defibrillate.
Deflagrators deflagrate.
Deflators deflate.
Deflocculators deflocculate.
Defoliators defoliate.
Degerminators degerminate.
Dehydrators dehydrate.
Dejerators dejerate.
Delators delate.
Delegators delegate.
Deliberators deliberate.
Delineators delineate.
Demarcators demarcate.
Demodulators demodulate.
Demonstrators demonstrate.
Denigrators denigrate.
Denitrators denitrate.
Denominators denominate.
Denunciators denunciate.
Deoxidators deoxidate.
Dephlegmators dephlegmate.
Depilators depilate.
Depopulators depopulate.
Deprecators deprecate.
Depreciators depreciate.
Depredators depredate.
Depurators depurate.
Derogators derogate.
Desiccators desiccate.
Designators designate.
Deteriorators deteriorate.
Determinators determinate.
Detonators detonate.
Detoxicators detoxicate.
Devastators devastate.
Deviators deviate.
Devirginators devirginate.
Dialyzators dialyzate.
Dictators dictate.
Differentiators differentiate.
Digladiators digladiate.
Dilapidators dilapidate.
Dilatators dilatate.
Dilators dilate.
Disambiguators disambiguate.
Disarticulators disarticulate.
Discriminators discriminate.
Disintegrators disintegrate.
Dislocators dislocate.
Dismembrators dismembrate.
Dispensators dispensate.
Dispergators dispergate.
Disseminators disseminate.
Dissertators dissertate.
Dissimulators dissimulate.
Dissipators dissipate.
Divaricators divaricate.
Domesticators domesticate.
Dominators dominate.
Donators donate.
Duplicators duplicate.
Educators educate.
Edulcorators edulcorate.
Ejaculators ejaculate.
Elaborators elaborate.
Elators elate.
Elevators elevate.
Eliminators eliminate.
Elucidators elucidate.
Elutriators elutriate.
Emanators emanate.
Emancipators emancipate.
Emasculators emasculate.
Emendators emendate.
Emigrators emigrate.
Emulators emulate.
Enervators enervate.
Enucleators enucleate.
Enumerators enumerate.
Enunciators enunciate.
Epilators epilate.
Equators equate.
Equilibrators equilibrate.
Equivocators equivocate.
Eradicators eradicate.
Escalators escalate.
Estimators estimate.
Estivators estivate.
Evacuators evacuate.
Evaluators evaluate.
Evaporators evaporate.
Evocators evocate.
Exaggerators exaggerate.
Examinators examinate.
Excavators excavate.
Excogitators excogitate.
Excommunicators excommunicate.
Excoriators excoriate.
Excruciators excruciate.
Execrators execrate.
Exhilarators exhilarate.
Exhumators exhumate.
Exonerators exonerate.
Expatiators expatiate.
Expectorators expectorate.
Expiators expiate.
Expilators expilate.
Expirators expirate.
Expiscators expiscate.
Explanators explanate.
Explicators explicate.
Expostulators expostulate.
Expropriators expropriate.
Expurgators expurgate.
Exsiccators exsiccate.
Extenuators extenuate.
Exterminators exterminate.
Extirpators extirpate.
Extrapolators extrapolate.
Fabricators fabricate.
Facilitators facilitate.
Falsificators falsificate.
Fascinators fascinate.
Fecundators fecundate.
Federators federate.
Felicitators felicitate.
Filators filate.
Fixators fixate.
Flagellators flagellate.
Flocculators flocculate.
Formulators formulate.
Fornicators fornicate.
Fractionators fractionate.
Fulgurators fulgurate.
Fulminators fulminate.
Fumigators fumigate.
Funambulators funambulate.
Fustigators fustigate.
Gators gate.
Generators generate.
Germinators germinate.
Gesticulators gesticulate.
Gladiators gladiate.
Glossators glossate.
Graduators graduate.
Granulators granulate.
Gyrators gyrate.
Habilitators habilitate.
Hallucinators hallucinate.
Hereticators hereticate.
Hesitators hesitate.
Hibernators hibernate.
Hospitators hospitate.
Humiliators humiliate.
Hydrators hydrate.
Hydrogenators hydrogenate.
Hypothecators hypothecate.
Illuminators illuminate.
Illustrators illustrate.
Imaginators imaginate.
Imitators imitate.
Immigrators immigrate.
Immolators immolate.
Impanators impanate.
Imperators imperate.
Impersonators impersonate.
Impetrators impetrate.
Importunators importunate.
Imprecators imprecate.
Impregnators impregnate.
Impropriators impropriate.
Improvisators improvisate.
Inaugurators inaugurate.
Incarcerators incarcerate.
Incinerators incinerate.
Incorporators incorporate.
Incriminators incriminate.
Incrustators incrustate.
Incubators incubate.
Inculcators inculcate.
Indagators indagate.
Indicators indicate.
Individuators individuate.
Indoctrinators indoctrinate.
Infatuators infatuate.
Infiltrators infiltrate.
Inflators inflate.
Initiators initiate.
Innovators innovate.
Inoculators inoculate.
Insinuators insinuate.
Inspissators inspissate.
Instaurators instaurate.
Instigators instigate.
Insufflators insufflate.
Insulators insulate.
Integrators integrate.
Intercommunicators intercommunicate.
Intermediators intermediate.
Interpellators interpellate.
Interpolators interpolate.
Interrogators interrogate.
Intimidators intimidate.
Intonators intonate.
Intoxicators intoxicate.
Intubators intubate.
Inundators inundate.
Invalidators invalidate.
Investigators investigate.
Invigilators invigilate.
Invigorators invigorate.
Invocators invocate.
Irradiators irradiate.
Irrigators irrigate.
Irritators irritate.
Jaculators jaculate.
Judicators judicate.
Laminators laminate.
Lapidators lapidate.
Legators legate.
Legislators legislate.
Levigators levigate.
Levitators levitate.
Liberators liberate.
Ligators ligate.
Liquidators liquidate.
Literators literate.
Litigators litigate.
Lixiviators lixiviate.
Locators locate.
Lubricators lubricate.
Lucubrators lucubrate.
Luminators luminate.
Machinators machinate.
Malaxators malaxate.
Mandators mandate.
Manipulators manipulate.
Masticators masticate.
Masturbators masturbate.
Matriculators matriculate.
Mediators mediate.
Medicators medicate.
Meditators meditate.
Meliorators meliorate.
Methylators methylate.
Migrators migrate.
Miniators miniate.
Miscalculators miscalculate.
Miscegenators miscegenate.
Miscreators miscreate.
Mitigators mitigate.
Moderators moderate.
Modulators modulate.
Monochromators monochromate.
Monstrators monstrate.
Motivators motivate.
Multiplicators multiplicate.
Mutilators mutilate.
Narrators narrate.
Navigators navigate.
Negators negate.
Negotiators negotiate.
Nitrators nitrate.
Nivellators nivellate.
Nomenclators nomenclate.
Nominators nominate.
Notators notate.
Novators novate.
Nucleators nucleate.
Numerators numerate.
Obfuscators obfuscate.
Objurgators objurgate.
Obligators obligate.
Obliterators obliterate.
Obtruncators obtruncate.
Obturators obturate.
Obviators obviate.
Odorators odorate.
Officiators officiate.
Operators operate.
Orators orate.
Orchestrators orchestrate.
Ordinators ordinate.
Orientators orientate.
Originators originate.
Oscillators oscillate.
Osculators osculate.
Oxidators oxidate.
Oxygenators oxygenate.
Ozonators ozonate.
Pacificators pacificate.
Palliators palliate.
Participators participate.
Peculators peculate.
Pedipulators pedipulate.
Penetrators penetrate.
Perambulators perambulate.
Percolators percolate.
Peregrinators peregrinate.
Perfectionators perfectionate.
Perforators perforate.
Perlustrators perlustrate.
Permeators permeate.
Permutators permutate.
Perorators perorate.
Perpetrators perpetrate.
Perpetuators perpetuate.
Perscrutators perscrutate.
Personators personate.
Perturbators perturbate.
Plicators plicate.
Pollinators pollinate.
Populators populate.
Postillators postillate.
Postulators postulate.
Potators potate.
Precipitators precipitate.
Predators predate.
Predestinators predestinate.
Predicators predicate.
Prediscriminators prediscriminate.
Predominators predominate.
Prefabricators prefabricate.
Preinvestigators preinvestigate.
Premeditators premeditate.
Preoperators preoperate.
Preseparators preseparate.
Prestidigitators prestidigitate.
Prestigiators prestigiate.
Prevaricators prevaricate.
Probators probate.
Procrastinators procrastinate.
Procreators procreate.
Procurators procurate.
Prognosticators prognosticate.
Promulgators promulgate.
Pronators pronate.
Propagators propagate.
Propitiators propitiate.
Prorogators prorogate.
Prostrators prostrate.
Pulsators pulsate.
Pulverizators pulverizate.
Punctators punctate.
Punctuators punctuate.
Radiators radiate.
Radiolocators radiolocate.
Ratiocinators ratiocinate.
Recapitulators recapitulate.
Reciprocators reciprocate.
Reconciliators reconciliate.
Recreators recreate.
Recriminators recriminate.
Recuperators recuperate.
Redintegrators redintegrate.
Refrigerators refrigerate.
Regenerators regenerate.
Registrators registrate.
Regrators regrate.
Regulators regulate.
Rehypothecators rehypothecate.
Reinstators reinstate.
Rejuvenators rejuvenate.
Relators relate.
Relevators relevate.
Relocators relocate.
Remonstrators remonstrate.
Remunerators remunerate.
Renovators renovate.
Renunciators renunciate.
Reprobators reprobate.
Repudiators repudiate.
Resonators resonate.
Resuscitators resuscitate.
Retaliators retaliate.
Reverberators reverberate.
Rotators rotate.
Rubiators rubiate.
Rubricators rubricate.
Ruinators ruinate.
Ruminators ruminate.
Rusticators rusticate.
Salivators salivate.
Saltators saltate.
Saturators saturate.
Scintillators scintillate.
Scrutators scrutate.
Segregators segregate.
Senators senate.
Separators separate.
Sequestrators sequestrate.
Sibilators sibilate.
Signators signate.
Significators significate.
Simulators simulate.
Somnambulators somnambulate.
Sophisticators sophisticate.
Spectators spectate.
Speculators speculate.
Spoliators spoliate.
Stannators stannate.
Stimulators stimulate.
Stipulators stipulate.
Stridulators stridulate.
Strigilators strigilate.
Subadministrators subadministrate.
Subcurators subcurate.
Subjugators subjugate.
Sublimators sublimate.
Substantiators substantiate.
Substrators substrate.
Sulfonators sulfonate.
Sulfurators sulfurate.
Sulphonators sulphonate.
Sulphurators sulphurate.
Supererogators supererogate.
Superseminators superseminate.
Supinators supinate.
Supplicators supplicate.
Syncopators syncopate.
Syndicators syndicate.
Tabulators tabulate.
Tergiversators tergiversate.
Terminators terminate.
Testators testate.
Testificators testificate.
Titillators titillate.
Titivators titivate.
Titrators titrate.
Tolerators tolerate.
Tractators tractate.
Transilluminators transilluminate.
Translators translate.
Transliterators transliterate.
Transmigrators transmigrate.
Triangulators triangulate.
Triturators triturate.
Truncators truncate.
Tubulators tubulate.
Urinators urinate.
Vaccinators vaccinate.
Vacillators vacillate.
Valuators valuate.
Variators variate.
Variegators variegate.
Vaticinators vaticinate.
Venerators venerate.
Ventilators ventilate.
Vibrators vibrate.
Vindicators vindicate.
Violators violate.
Vitiators vitiate.
Vituperators vituperate.
Vivificators vivificate.
Vociferators vociferate.

occupations

an automatically generated minimalistic drama in english. for the german version go here: 
https://soundcloud.com/jpiringer/ich-du


ME:		me. 
YOU:	you!
ME:		me. 
YOU:	you!
ME:		me. me. me. 
YOU:	you you you!
ME:		me. me. 
YOU:	you you!
ME:		me. me. me. 
YOU:	you you you!
ME:		me. me. 
YOU:	you you!
ME:		me. 
YOU:	you!
ME:		me. me. me. me. me. me. 
YOU:	you you you you you you!

me you

every word of the "Universal Declaration of Human Rights" is reduced by a stemming algorithm to its word stem (its root, its radix).
there's also a german version here: https://soundcloud.com/jpiringer/allgemein-erklar-der-menschenrecht

univers declar of human right

wherea recognit of the inher digniti and of the equal and inalien right of all member of the human famili is the foundat of freedom justic and peac in the world wherea disregard and contempt for human right have result in barbar act which have outrag the conscienc of mankind and the advent of a world in which human be shall enjoy freedom of speech and belief and freedom from fear and want has been proclaim as the highest aspir of the common peopl wherea it is essenti if man is not to be compel to have recours as a last resort to rebellion against tyranni and oppress that human right should be protect by the rule of law wherea it is essenti to promot the develop of friend relat between nation wherea the peopl of the unit nation have in the charter reaffirm their faith in fundament human right in the digniti and worth of the human person and in the equal right of men and women and have determin to promot social progress and better standard of life in larger freedom wherea member state have pledg themselv to achiev in cooper with the unit nation the promot of univers respect for and observ of human right and fundament freedom wherea a common understand of these right and freedom is of the greatest import for the full realiz of this pledg now therefor the general assembl proclaim this univers declar of human right as a common standard of achiev for all peopl and all nation to the end that everi individu and everi organ of societi keep this declar constant in mind shall strive by teach and educ to promot respect for these right and freedom and by progress measur nation and intern to secur their univers and effect recognit and observ both among the peopl of member state themselv and among the peopl of territori under their jurisdict articl all human be are born free and equal in digniti and right they are endow with reason and conscienc and should act toward one anoth in a spirit of brotherhood articl everyon is entitl to all the right and freedom set forth in this declar without distinct of ani kind such as race colour sex languag religion polit or other opinion nation or social origin properti birth or other status furthermor no distinct shall be made on the basi of the polit jurisdict or intern status of the countri or territori to which a person belong whether it be independ trust nonselfgovern or under ani other limit of sovereignti articl everyon has the right to life liberti and secur of person articl no one shall be held in slaveri or servitud slaveri and the slave trade shall be prohibit in all their form articl no one shall be subject to tortur or to cruel inhuman or degrad treatment or punish articl everyon has the right to recognit everywher as a person befor the law articl all are equal befor the law and are entitl without ani discrimin to equal protect of the law all are entitl to equal protect against ani discrimin in violat of this declar and against ani incit to such discrimin articl everyon has the right to an effect remedi by the compet nation tribun for act violat the fundament right grant him by the constitut or by law articl no one shall be subject to arbitrari arrest detent or exil articl everyon is entitl in full equal to a fair and public hear by an independ and imparti tribun in the determin of his right and oblig and of ani crimin charg against him articl everyon charg with a penal offenc has the right to be presum innoc until prove guilti accord to law in a public trial at which he has had all the guarante necessari for his defenc no one shall be held guilti of ani penal offenc on account of ani act or omiss which did not constitut a penal offenc under nation or intern law at the time when it was commit nor shall a heavier penalti be impos than the one that was applic at the time the penal offenc was commit articl no one shall be subject to arbitrari interfer with his privaci famili home or correspond nor to attack upon his honour and reput everyon has the right to the protect of the law against such interfer or attack articl everyon has the right to freedom of movement and resid within the border of each state everyon has the right to leav ani countri includ his own and to return to his countri articl everyon has the right to seek and to enjoy in other countri asylum from persecut this right may not be invok in the case of prosecut genuin aris from nonpolit crime or from act contrari to the purpos and principl of the unit nation articl everyon has the right to a nation no one shall be arbitrarili depriv of his nation nor deni the right to chang his nation articl men and women of full age without ani limit due to race nation or religion have the right to marri and to found a famili they are entitl to equal right as to marriag dure marriag and at it dissolut marriag shall be enter into onli with the free and full consent of the intend spous the famili is the natur and fundament group unit of societi and is entitl to protect by societi and the state articl everyon has the right to own properti alon as well as in associ with other no one shall be arbitrarili depriv of his properti articl everyon has the right to freedom of thought conscienc and religion this right includ freedom to chang his religion or belief and freedom either alon or in communiti with other and in public or privat to manifest his religion or belief in teach practic worship and observ articl everyon has the right to freedom of opinion and express this right includ freedom to hold opinion without interfer and to seek receiv and impart inform and idea through ani media and regardless of frontier articl everyon has the right to freedom of peac assembl and associ no one may be compel to belong to an associ articl everyon has the right to take part in the govern of his countri direct or through freeli chosen repres everyon has the right to equal access to public servic in his countri the will of the peopl shall be the basi of the author of govern this will shall be express in period and genuin elect which shall be by univers and equal suffrag and shall be held by secret vote or by equival free vote procedur articl everyon as a member of societi has the right to social secur and is entitl to realiz through nation effort and intern cooper and in accord with the organ and resourc of each state of the econom social and cultur right indispens for his digniti and the free develop of his person articl everyon has the right to work to free choic of employ to just and favour condit of work and to protect against unemploy everyon without ani discrimin has the right to equal pay for equal work everyon who work has the right to just and favour remuner ensur for himself and his famili an exist worthi of human digniti and supplement if necessari by other mean of social protect everyon has the right to form and to join trade union for the protect of his interest articl everyon has the right to rest and leisur includ reason limit of work hour and period holiday with pay articl everyon has the right to a standard of live adequ for the health and wellb of himself and of his famili includ food cloth hous and medic care and necessari social servic and the right to secur in the event of unemploy sick disabl widowhood old age or other lack of livelihood in circumst beyond his control motherhood and childhood are entitl to special care and assist all children whether born in or out of wedlock shall enjoy the same social protect articl everyon has the right to educ educ shall be free at least in the elementari and fundament stage elementari educ shall be compulsori technic and profession educ shall be made general avail and higher educ shall be equal access to all on the basi of merit educ shall be direct to the full develop of the human person and to the strengthen of respect for human right and fundament freedom it shall promot understand toler and friendship among all nation racial or religi group and shall further the activ of the unit nation for the mainten of peac parent have a prior right to choos the kind of educ that shall be given to their children articl everyon has the right freeli to particip in the cultur life of the communiti to enjoy the art and to share in scientif advanc and it benefit everyon has the right to the protect of the moral and materi interest result from ani scientif literari or artist product of which he is the author articl everyon is entitl to a social and intern order in which the right and freedom set forth in this declar can be fulli realiz articl everyon has duti to the communiti in which alon the free and full develop of his person is possibl in the exercis of his right and freedom everyon shall be subject onli to such limit as are determin by law sole for the purpos of secur due recognit and respect for the right and freedom of other and of meet the just requir of moral public order and the general welfar in a democrat societi these 

univers declar of human right

my first ever cover of a song. „Drive“ by R.E.M.

Drive (REM Cover)

aba baba caba daba faba gaba maba paba saba yaba.
abby babby cabby dabby gabby nabby tabby wabby yabby shabby.
acker backer dacker hacker jacker lacker packer racker sacker tacker wacker thacker stacker.
addle caddle daddle faddle maddle paddle quaddle raddle saddle waddle staddle.
ade bade cade dade fade gade hade jade lade made sade tade vade wade yade shade stade.
age cage fage gage mage page rage sage vage wage stage.
ager cager eager fager gager jager lager pager rager wager stager.
agger bagger dagger fagger gagger hagger jagger lagger nagger ragger sagger tagger wagger yagger stagger.
aid caid kaid laid maid naid paid raid said staid.
ail bail dail fail gail hail jail kail mail nail pail quail rail sail tail vail wail.
ain bain cain dain fain gain hain jain lain main nain pain rain sain tain vain wain zain stain.
air fair gair hair lair nair pair sair vair yair stair.
ake bake cake fake hake jake lake make nake quake rake sake take wake shake stake.
ale bale dale gale hale kale male pale quale rale sale tale vale wale yale shale stale.
ali bali cali dali gali kali mali pali tali vali wali yali.
all ball call fall gall hall lall mall pall tall vall wall shall stall.
allow ballow callow fallow hallow mallow sallow tallow wallow yallow shallow.
ally bally dally fally gally lally pally rally sally tally wally.
alt balt dalt galt halt malt palt salt walt shalt.
ama dama fama jama kama lama mama nama rama tama yama zama shama.
ame came dame fame game hame kame lame name rame same tame wame shame.
ammer dammer gammer hammer jammer lammer mammer rammer sammer yammer shammer stammer.
amp camp damp gamp lamp ramp samp tamp vamp wamp yamp stamp.
amper camper damper hamper lamper pamper ramper tamper vamper stamper.
ana bana cana dana fana kana lana mana nana rana sana tana yana thana.
and band cand dand fand gand hand land mand pand rand sand wand stand.
andy bandy candy dandy handy kandy pandy quandy randy sandy tandy wandy shandy.
ane bane cane dane gane jane lane mane nane pane rane sane tane vane wane thane shane stane.
ang bang dang fang gang hang kang mang pang rang sang tang uang vang wang yang shang stang.
angle bangle cangle dangle fangle hangle jangle langle mangle rangle tangle wangle.
anker banker canker hanker janker ranker tanker wanker yanker thanker shanker.
ant bant cant fant gant hant kant lant mant nant pant quant rant sant want zant shant.
ara bara cara gara jara mara nara para sara tara vara.
are aare bare care dare fare gare hare mare pare quare rare sare tare vare ware yare share stare.
ark bark cark dark hark lark mark nark park quark sark wark yark shark stark.
arn barn darn earn garn harn larn tarn warn yarn sharn starn.
arrow barrow carrow darrow farrow harrow marrow narrow tarrow yarrow.
arry barry carry harry jarry larry marry parry quarry tarry sharry starry.
art bart cart dart fart hart mart part quart sart tart wart start.
ash bash cash dash fash gash hash lash mash nash pash quash rash sash tash wash stash.
ass bass cass fass jass lass mass pass sass tass.
ast bast cast east fast gast last mast nast oast past vast wast.
aster baster caster easter faster gaster haster laster master paster raster taster waster shaster.
ate bate cate date fate gate hate kate late mate nate pate rate sate tate yate state.
atter batter fatter gatter hatter latter matter natter patter ratter tatter vatter yatter shatter.
ave aave cave dave eave gave have lave nave pave quave rave save tave wave thave shave stave.
aver daver eaver haver javer laver paver quaver raver saver taver waver shaver staver.
awn bawn dawn fawn gawn lawn pawn sawn tawn yawn thawn shawn stawn.
bit ebit gbit kbit mbit obit pbit tbit ybit zbit.
ean bean dean gean jean kean lean mean pean quean sean tean wean yean shean stean.
ear bear dear fear gear hear lear near pear rear sear tear wear year shear.
eat beat feat geat heat leat meat neat peat seat teat yeat theat sheat.
eave deave heave leave reave seave teave weave theave sheave.
eck beck deck feck geck heck keck leck neck peck reck seck teck.
eel feel heel jeel keel neel peel reel seel teel weel yeel steel.
eer beer deer feer heer jeer leer neer peer queer seer teer veer theer sheer steer.
eld beld geld held keld meld veld weld yeld sheld.
ell bell cell dell fell gell hell jell kell mell nell pell quell sell tell vell well yell shell stell.
elt belt celt felt gelt kelt melt pelt selt telt welt yelt.
end bend fend hend kend lend mend pend rend send tend vend wend zend shend stend.
ender bender fender gender lender mender render sender tender vender yender.
ere bere cere dere here mere sere were yere there stere.
ern bern cern dern fern hern kern pern quern tern vern yern stern.
ess bess cess dess fess hess jess less mess ness pess sess tess.
est best cest fest gest hest jest lest nest pest quest rest test vest west yest zest.
ester bester fester hester jester lester mester nester pester quester rester tester vester wester yester.
eta beta geta keta meta seta veta weta yeta zeta theta.
etch fetch ketch letch quetch retch tetch vetch thetch stetch.
ice bice dice fice mice nice pice rice sice tice vice wice shice.
icky dicky micky nicky picky quicky ricky ticky vicky wicky sticky.
ide aide bide fide gide hide lide mide nide ride side tide wide shide.
ike bike dike fike hike kike like mike nike pike sike tike.
ill bill dill fill gill hill jill kill lill mill pill quill rill sill till vill will yill zill thill shill still.
illy billy dilly filly gilly hilly killy milly quilly rilly silly tilly willy thilly stilly.
ilo bilo dilo filo gilo hilo kilo lilo milo silo.
inch cinch finch hinch kinch linch pinch quinch rinch winch.
ind bind find hind kind lind mind pind rind sind tind wind.
ing bing ding ging hing jing king ling ming ning ping ring sing ting wing zing thing sting.
inge binge dinge hinge linge minge ringe singe tinge stinge.
inger binger finger ginger hinger linger pinger ringer singer tinger winger zinger stinger.
ingle bingle cingle dingle hingle jingle mingle pingle ringle single tingle wingle shingle.
ink bink dink fink gink jink kink link mink oink pink quink rink sink tink wink zink think stink.
inker jinker linker pinker rinker sinker tinker winker thinker stinker.
inner dinner finner ginner pinner rinner sinner tinner winner thinner shinner.
inning binning ginning minning pinning sinning tinning winning thinning shinning.
inter cinter hinter linter minter pinter sinter tinter winter stinter.
ion aion bion cion dion lion pion sion zion stion.
ira aira cira eira lira mira quira rira vira zira.
ire aire dire eire fire hire lire mire quire sire tire vire wire shire.
irk birk dirk firk kirk mirk quirk yirk shirk stirk.
ist cist fist gist hist kist list mist nist pist rist sist wist.
itch aitch bitch ditch fitch hitch litch mitch nitch pitch quitch sitch witch stitch.
ither cither dither either hither nither tither wither zither thither shither.
ock bock cock dock hock jock lock mock nock pock rock sock tock yock shock stock.
ode bode code dode gode lode mode node rode tode wode shode.
oil boil coil foil koil moil noil poil roil soil toil.
ola bola cola dola gola kola lola mola sola zola shola stola.
old bold cold fold gold hold mold sold told wold.
ole bole cole dole fole hole mole pole role sole tole vole thole shole stole.
one bone cone done gone hone ione lone mone none pone rone sone tone wone zone thone shone stone.
ope cope dope hope lope mope nope pope rope sope tope stope.
ora bora cora dora fora gora hora kora lora mora nora sora tora.
oral boral coral goral horal loral moral poral roral soral toral thoral.
ore bore core fore gore kore lore more pore sore tore wore yore thore shore store.
ort bort fort mort oort port sort tort wort thort short.
ory cory dory gory hory kory lory pory rory sory tory story.
ose bose dose hose jose lose mose nose pose rose those.
otter cotter dotter hotter jotter lotter potter rotter sotter totter shotter stotter.
ough bough cough dough hough jough lough rough sough tough wough though.
our dour four hour lour pour sour tour your stour.
ouse bouse douse house louse mouse rouse souse touse youse thouse.
out bout dout gout lout mout pout rout tout shout stout.
outer couter douter fouter louter pouter router souter touter shouter.
ower bower cower dower jower lower mower power rower sower tower vower shower stower.
owl bowl cowl dowl fowl gowl howl jowl sowl yowl.
ram aram bram cram dram fram gram pram tram thram shram stram.
ran bran cran gran iran kran oran quran tran uran wran.
ree bree cree dree free gree tree three shree stree.
rill brill drill frill grill krill prill trill thrill shrill.
row arow brow crow drow frow grow prow trow throw strow.
udder budder dudder judder mudder pudder rudder sudder shudder studder.
ula aula fula gula hula kula lula pula sula tula.
ull bull cull dull full gull hull lull mull null pull rull sull wull stull.
uller buller culler duller fuller huller luller muller puller ruller stuller.
umble bumble fumble humble jumble mumble numble rumble tumble wumble thumble stumble.
ump bump cump dump gump hump jump lump mump pump rump sump tump thump stump.
ura aura bura dura hura jura kura lura mura sura.
ure bure cure dure hure jure lure mure pure sure shure.
ush bush cush dush gush hush lush mush push rush tush wush shush.
usher busher gusher husher lusher musher pusher rusher tusher shusher.
ust bust dust fust gust just lust must oust rust wust.
ute aute bute cute fute jute lute mute tute shute.
utter butter cutter gutter mutter nutter putter rutter thutter shutter stutter.

start letters (english)

a semi-automatically generated text created by using the word suggestion function of iOS 8.

Vorschlag für die Zukunft 

Das war eine der größten deutschen Markt für die Einladung zu einer Zeit wo ich mich nicht mehr so lange wie möglich in den nächsten Monaten und die Kinder und die Sonne und die anderen beiden Seiten der Regierung in der Regel nicht mehr so gut wie keine Probleme mehr mit dem Auto in der Schule und ich habe mich schon auf dem Weg zur Arbeit fahren wir mit der neuen Saison zwei tausend und zwölf Uhr mittags hinzulegen und ich hab es nicht mehr zu gebrauchen können die Kinder sind sie auch noch ein bisschen später noch einmal die Möglichkeit der Arbeit. 
Ich bin jetzt auch noch nicht einmal mehr die Rede von den anderen beiden Fällen nicht mehr zu gebrauchen ist das ein bisschen später dran denken sie bitte um Hilfe bitten um Entschuldigung bitten um Verständnis dafür haben die Kinder und die Sonne und es gibt keine Ahnung was das Zeug zum Beispiel für eine Woche später auch nicht so einfach ist es auch noch nicht einmal mehr als ein hundert und mehr als ein hundert Meter weiter so und jetzt ist es nicht mehr so viel wie möglich zu machen und dann noch mal ein paar Tage nach dem ersten Weltkrieg und die anderen beiden Seiten der Regierung in der Stadt und Land der Welt und ich bin ein bisschen mehr. 
Die beiden anderen beiden Fällen nicht so viel zu viel für mich nicht so viel zu viel für mich nicht so gut und die Kinder sind wir in den nächsten Wochen in den nächsten Monaten nicht so viel wie geht das auch. Das kann ja wohl ein Witz ist das denn bitte für ein neues Leben ist das denn bitte der Stadt zu Hause ist das ein hundert Prozent auf den Markt zu den Favoriten bei mir auch schon die erste Mannschaft der Liga der Stadt zu Hause ist und ich hab das mal so ein hundert Prozent auf den Markt zu den Markt gebracht und ich hab das mal so schlecht und das mit den Markt bringen kann es auch in diesem Bereich ist ein schöner als der andere nicht aus den nächsten Monaten. 
Ich bin jetzt schon auf den ersten Platz der Luftbrücke der Stadt und die Kinder sind sie nicht so einfach ist es ein wenig später in die Hand nehmen wir die Kinder. 



vorschlag für die zukunft

a semi-automatically generated text created by using the word suggestion function of iOS 8:

Suggestion for the next few weeks 

I don't think that I have a great way of the day before I get a follow back on my way home from work to be the first half of the day before the end of the year and I don't think that I have a great way of life and the day I have to go back. 
I'm at a time when you are so much for a long way in hell of the best way for me I was in my room for a long way in hell of the best way for me I was in my room for a few years and years in a row in my head hurts so bad I don't have the right way too long and the best of all of them were a lot to be able a good idea of what is your own music. 
The best way to get a new one is the best way to get a new one is the best way to get a new one is the best way to get a new one is the best way to get a new one is the best way to get a new one. 
I don't have to go home and sleep and I don't have to go home and sleep and I don't think I can be a great way to get the same time as well as a new one and the best thing about to get a follow from you would like a week. 

Suggestion For The Next Few Weeks

the computer calculates portmanteau-words (a portmanteau is a combination of two or more words and their meanings into a single new word)by searching the dictionary. that's the german version.
the english version is here: https://soundcloud.com/jpiringer/portmanteau-english

Zimperlichereignisschleifensterlaibungenüge.
Kleinbühnennenswertestplandeshauptausschüsse.
Erbverfahrensembleformengengerüstennisturnier.
Freibrenngrenzentralisiertestpinsiderkenntnisse.
Vorspannfilmchensembleleiterntevorrätenorsaxofons.
Viehzeugenischessischenkelkorbiternstfallesepulte.
Diebesnestländerleimhaltigesundheitshalberechnungspraxis.
Frankophonennenderangiertemperaturhöchstwerträumtestragons.
Beschuldigungemeinervenkulturnteamselfeldermatologischemdenstoffe.
Kultursekretariatemschutzeinsatzzeitensorgleichungenusssüchtigerte.
Trainingsstützpunktestmodellenwarentengewährungenossenschaftslehre.
Erregendstestblockesselschluchtendenziösereservesystemsigsteilspiel.
Führungsfähigkeiterndesignerphilosophinauswerfenddarmbereichenkersmahlbecks.
Basiskommunikationennenswertemperaturabweichungelapptennislaufbahnennachweisegrimstande.
Steuerabzugsberechtigungeneralgutsverwalterminzustandachtsliteraturmführungefedertränkt.
Logierendenkerischenkellocheisensemblespielenkunterstützungehemmternärrischeressortchefs.
Abschusssequenzymatischemisphärennkalkülenkbefehlenkradfernbedienungeneralbassinstrumente.
Transaktionssystemsigkeitergangesäterrorisiertesteinrichtungewöhnlichstehplatzinhabergbaueinfluss.
Entlegensterroraktionisierbarockpferdenkmalverwaltungenussmittelarbeitergewerkschaftennislehrgänge.
Schneeregionennleistunglückszugentfernunglückssträhnennbeträgenusssteigerungeneralvorzeichenkelkorbs.
Gezwinkertestendemonstrationsflügenossenschaftswegeneralverbotennisspieleserkreiskunstlaufwettbewerbotennisikone.
Vertrotteltestprotokollenkbarennpauserportsfeuerwehrvereineffektivereignisbehandlungsroutineffizientennisfantasielose.
Gerinnungsbadehäuschensemblekursachenbezogenemesistierennfahrerstilgendenkpotenzialenkflugkörpersönlichkeitsdiagnostik.
Beuysscherzneurosendezielessingschessinnentstellendereferenzierbaremouladenaturierendespotischerstellungstemperaturennkarrierennsportgruppe.
Nordwestägäischessischeopspyramidentifikationsmerkmalendengurtennisfreundesinfizierensembleleitungebleichteststrukturbosegelsbethnolinguistik.
Haselnüsschenkellerwirtschaftentakelchhausesshaftemperaturbestimmungenussfreudigeltypischenkersknechtennisstarifvariantentativentilzahlbecktanne.
Fahrerfeldoradoptionsantragoutlawinengefährdetektierbarespektablerninhaltstoffsammelzentrumsatzfaktorstäbenediktinerklosterkirchemieschutzanzüge.
Sterndünennenswertereignisartendiertastendenkmalsetzungenerationszusammenhangehauchtestausgangeleimtennisfreundenkmalplangzeitgitarristhmusikkonzerte.
Kartenausgabenutzungsrechthonischlafsackerwagenreifensterumschlageschlageneralbassliedesignbeschreibungehobelteremissionisiereignendrohrleisteinbruchlochessensembleprogramme.
Kulturarbeitsplanesteltennismaschinennleistungetestetesteintragendteenagernährungsumschausmeisterdienstellenvergabendmahlsgemeinschafterbürdenaturierendesignpreisensomotorischenkelmannonciertragslosgeschnalltennissandplatzessionarezzos.

portmanteau (german)

the computer calculates portmanteau-words (a portmanteau is a combination of two or more words and their meanings into a single new word)by searching the dictionary. that's the english version.
the german version is here: https://soundcloud.com/jpiringer/portmanteau-german

Mercalyculatemporalegh.
Mustacheddleresissoodly.
Intonederlandroidalibarda.
Ozonicoticktockhambleaberry.
Synchronallahorestesteewhaap.
Mayfowlspiegleesomenessential.
Perstringementoconeheartedium.
Rejoicefulicinaegatenolollardy.
Disorientatenisthmiatestinevidence.
Portunaliabilityluscioustingluvies.
Beholdingnessayisthmianthinitemize.
Bevinedderogationophoresismotherapyrexy.
Chuddarjeelingomarsupialianthinadvisedly.
Photochromentumulatelognathianakotoconium.
Archontatelognathiatussoreophasinaebodylize.
Calemesomyodianthinalienablephariglottissual.
Alteringrownnessayisherwoodlessonneratiaceae.
Stylographelopsoninetiethylhydrocupreinelegancy.
Anabathmoskermanshahnemannianthinapprehensionicize.
Pneumatophonickneventrocaudalbergiansarcasmproofbird.
Alexandrineffervescibilitylustrantimonicesomentopexy.
Noncontributionogeniohyoglossuspicionablendcornithivoroustertial.
Tubulibranchiatacamitemizerothertimerinadventurousterminaliaceae.
Forkednessenicalandraftswomanshipparchustonometrygonidichotomisationicize.
Lakishnessoineedlemakingrosseocartilaginoustermitaryanismailianthineptitude.
Asimovablephariglottissuessionestledgingrossiculardizabalaceoustermiterative.
Orthophosphorickshawkishnessenervatingrafterplayboykiniantickprooftishmaeliticktick.
Crustificationospherickracknowledgmentreasuredemandibulateleioticklishnessenwoodlespedeza.
Unsplinteredescentertainerveridicalantheriodickeraunophoneirodyniagaranklessorantasthmatickseededifferentiaterianthinauguralliformuzd.
Tunisianthinextensileitissuevianthinadequatelytroidiomycoticklenburgonianthiniteratelopodiammineludiblennocystitiswindblownnessayisticalomorphickwallotheismatickingurgitationophoresisterlessayismaelismailian.

portmanteau (english)

Sinikine

Zotupoto

Kasiosiko

Kawoe

Wawinike

i made a personal computer voice in macos sonoma.
to do this you have to repeat 150 sentences into the microphone. i only babbled into the microphone and did not really repeat the example sentences that the ai needs for training. that is the result. it sounds like speech but you can understand nothing at all.

babbel 1

i made a personal computer voice in macos sonoma.
to do this you have to repeat 150 sentences into the microphone. i only babbled into the microphone and did not really repeat the example sentences that the ai needs for training. that is the result. it sounds like speech but you can understand nothing at all.

the voice speeks the following text: abaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaabaababaababaabaababaababaabaababaabaababaababaabaababaababa

babbel 2

spoken with my personal babble computer voice:

aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy

babbel 3 - aaa eee iii ooo uuu yyy

my person computer babble voice speaks again

babble 4

generative speech experiment #2

probably the first sound file i published online on my website in 1997.
this track was meant as a comment on the results of the first internet literature competition by the german newspaper Die Zeit.
the jury statement indicated "21 trend-setting" ("richtungsweisend" in german) pieces. but in my opinion the jury was full of conservativism and mistrust against new technologies much like the german literary critics of today. i think that the internet literature competition of Die Zeit was not meant as a way to foster new forms of literature but to extend the hegemony of the the conservative literary establishment into the realm of the net. in that they suceeded. the vibrant german internet literature scene ceased to exist a few years later and has not recovered until now.

richtung

the colors of my facebook profile image spoken:
mittleres aquamarin dunklesseegrün dunkelgrau dunklesseegrün mittleres aquamarin dunklesseegrün mittleres aquamarin mittleres aquamarin mittleres aquamarin kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau dunklesseegrün mittleres aquamarin kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau dunklesseegrün dunklesseegrün mittleres aquamarin dunklesseegrün kadettenblau mittleres aquamarin mittleres aquamarin mittleres aquamarin mittleres aquamarin mittleres aquamarin dunklesseegrün mittleres aquamarin kadettenblau kadettenblau kadettenblau dunklesseegrün kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau dunklesseegrün kadettenblau dunklesseegrün mittleres aquamarin dunklesseegrün kadettenblau kadettenblau kadettenblau kadettenblau mittleres aquamarin dunklesseegrün mittleres aquamarin mittleres aquamarin mittleres aquamarin kadettenblau mittleres aquamarin mittleres aquamarin mittleres aquamarin mittleres aquamarin kadettenblau kadettenblau dunklesseegrün kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau mittleres aquamarin dunklesseegrün kadettenblau mittleres aquamarin mittleres aquamarin kadettenblau kadettenblau mittleres aquamarin mittleres aquamarin dunklesseegrün dunkelgrau grau dunklesolivgrün dunkelgrau dunkelgrau dunklesolivgrün grau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau kadettenblau mittleres aquamarin dunklesseegrün mittleres aquamarin mittleres aquamarin mittleres aquamarin mittleres aquamarin mittleres aquamarin kadettenblau dunklesseegrün dunklesolivgrün dunklesschiefergrau dunklesschiefergrau...

profile image colors

this is the second attempt to recreate my voice by a recurrent neuronal network (3 layers instead of 2 in the previous attempt) trained with a sample of my voice. the audio quality is quite low (8-bit 12khz)because of processing power restrictions.

rnn - voice 2

denk einmal 10 Sekunden nach
10 Sekunden nur
nur

10 Sekunden

three instances of a computer voice repeat the letter x with slightly different speech rates which results in rhythmic phasing.

phasing X

four fast computer speech layers reciting fibonacci syllable sequences.

more info here:
joerg.piringer.net/codepoetry/

Stine

darkvoice is an album and a set of videos reflecting on the role of spoken language in the age of pervasive and permanent electronic surveillance. it is exclusively made from manipulated voice, sinister typography and digital technology. 

for the full release go here:
http://joerg.piringer.net/darkvoice/

el sys

all digrams (sequences of two characters) and single characters i found in a german word list. the word list also includes some non-german words so there are some non-german digrams in the list.

read by the computer as if it was one word.

the list of digrams i extracted:
a aa ab ac ad ae af ag ah ai aj ak al am an ao ap aq ar as at au av aw ax ay az aß aä aç aî añ aö aü b ba bb bc bd be bf bg bh bi bj bk bl bm bn bo bp bq br bs bt bu bv bw by bz bä bé bö bü c ca cb cc cd ce cf cg ch ci cj ck cl cm co cq cr cs ct cu cy cz cä cé cí có cô d da db dc dd de df dg dh di dj dk dl dm dn do dp dq dr ds dt du dv dw dy dz dá dä dé dö dü e ea eb ec ed ee ef eg eh ei ej ek el em en eo ep eq er es et eu ev ew ex ey ez eß eä eñ eö eü f fa fb fc fd fe ff fg fh fi fj fk fl fm fn fo fp fq fr fs ft fu fv fw fy fz fä fé fö fü g ga gb gc gd ge gf gg gh gi gj gk gl gm gn go gp gq gr gs gt gu gv gw gy gz gä gé gö gü h ha hb hc hd he hf hg hh hi hj hk hl hm hn ho hp hq hr hs ht hu hv hw hy hz hâ hä hè hé hô hö hü i ia ib ic id ie if ig ih ii ij ik il im in io ip iq ir is it iu iv iw ix iz iß iä iè ië iö iü j ja je jg ji jo js ju jä jö jü k ka kb kc kd ke kf kg kh ki kj kk kl km kn ko kp kq kr ks kt ku kv kw ky kz kä kö kü l la lb lc ld le lf lg lh li lj lk ll lm ln lo lp lq lr ls lt lu lv lw ly lz là lä lé lí ló lö lü m ma mb mc md me mf mg mh mi mj mk ml mm mn mo mp mq mr ms mt mu mv mw my mz mä må mé mö mü n na nb nc nd ne nf ng nh ni nj nk nl nm nn no np nq nr ns nt nu nv nw nx ny nz nä nç né nö nü o oa ob oc od oe of og oh oi oj ok ol om on oo op oq or os ot ou ov ow ox oy oz oß oä oç oë oî oö oû oü p pa pb pc pd pe pf pg ph pi pj pk pl pm pn po pp pq pr ps pt pu pv pw py pz pä pæ pé pö pü q qm qs qu r ra rb rc rd re rf rg rh ri rj rk rl rm rn ro rp rq rr rs rt ru rv rw rx ry rz rä rç ré rê rö rü s sa sb sc sd se sf sg sh si sj sk sl sm sn so sp sq sr ss st su sv sw sy sz sá sä sé sö sø sü t ta tb tc td te tf tg th ti tj tk tl tm tn to tp tq tr ts tt tu tv tw ty tz tà tá tä tè té tó tö tü u ua ub uc ud ue uf ug uh ui uj uk ul um un uo up uq ur us ut uu uv uw ux uy uz uß uä ué uê uñ uö uü v va vb vc vd ve vf vg vh vi vk vl vm vn vo vp vq vr vs vt vu vv vw vy vz vä vé ví vö vü w wa wb wc wd we wf wg wh wi wj wk wl wm wn wo wp wr ws wt wu wv ww wy wä wö wü x xa xb xc xd xe xf xg xh xi xj xk xl xm xn xo xp xq xr xs xt xu xv xw xx xy xz y ya yb yc yd ye yf yg yh yi yj yk yl ym yn yo yp yr ys yt yu yv yw yx yz yä yè z za zb zc zd ze zf zg zh zi zj zk zl zm zn zo zp zq zr zs zt zu zv zw zy zz zá zä zö zü ß ßa ßb ßc ßd ße ßf ßg ßh ßi ßj ßk ßl ßm ßn ßo ßp ßq ßr ßs ßt ßu ßv ßw ßz ßä ßö ßü à á ál án ár ás ât ä äa äb äc äd äe äf äg äh äi äj äk äl äm än äo äp äq är äs ät äu äv äx äz äß ål æd ça ço çu èc èm èn èr èv é éa éb éc éd ée éh ék él ém én éo ép ér és ét éu év éw éz êp êt ëc ën ës ët í ía ík ís ît ñe ño ñu ód ók ór ôn ôt ö öa öb öc öd öe öf ög öh öi ök öl öm ön öo öp ör ös öt öv öw öx öz öß ør ût ü üb üc üd üe üf üg üh ük ül üm ün üo üp ür üs üt üv üx üz üß

more info here:
http://joerg.piringer.net/codepoetry/

all digrams

this is the complete genome of Covid-19 as a soundpoem.
source:
https://www.ncbi.nlm.nih.gov/nuccore/MN908947.3?report=fasta

ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTA...

complete Covid-19-genome as a soundpoem

the human genome. chromosome one (excerpt):
GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA
TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA
TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT
GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG
CTAGAAGAAAAGCATTGGGAAGTTTCCAACATGAAGAAAAGATAAATGGTCAAGGGAATG
GATATCCTAATTACCCTGATTTGATCATTATGCATTATATACATGAATCAAAATATCACA
CATACCTTCAAACTATGTACAAATATTATATACCAATAAAAAATCATCATCATCATCTCC
ATCATCACCACCCTCCTCCTCATCACCACCAGCATCACCACCATCATCACCACCACCATC
ATCACCACCACCACTGCCATCATCATCACCACCACTGTGCCATCATCATCACCACCACTG
TCATTATCACCACCACCATCATCACCAACACCACTGCCATCGTCATCACCACCACTGTCA
TTATCACCACCACCATCACCAACATCACCACCACCATTATCACCACCATCAACACCACCA
CCCCCATCATCATCATCACTACTACCATCATTACCAGCACCACCACCACTATCACCACCA
CCACCACAATCACCATCACCACTATCATCAACATCATCACTACCACCATCACCAACACCA
CCATCATTATCACCACCACCACCATCACCAACATCACCACCATCATCATCACCACCATCA
CCAAGACCATCATCATCACCATCACCACCAACATCACCACCATCACCAACACCACCATCA
CCACCACCACCACCATCATCACCACCACCACCATCATCATCACCACCACCGCCATCATCA
TCGCCACCACCATGACCACCACCATCACAACCATCACCACCATCACAACCACCATCATCA
CTATCGCTATCACCACCATCACCATTACCACCACCATTACTACAACCATGACCATCACCA
CCATCACCACCACCATCACAACGATCACCATCACAGCCACCATCATCACCACCACCACCA
CCACCATCACCATCAAACCATCGGCATTATTATTTTTTTAGAATTTTGTTGGGATTCAGT
ATCTGCCAAGATACCCATTCTTAAAACATGAAAAAGCAGCTGACCCTCCTGTGGCCCCCT
TTTTGGGCAGTCATTGCAGGACCTCATCCCCAAGCAGCAGCTCTGGTGGCATACAGGCAA
CCCACCACCAAGGTAGAGGGTAATTGAGCAGAAAAGCCACTTCCTCCAGCAGTTCCCTGT
CTGAGCTGCTGTCCTTGGACTTGAAGAAGCTTCTGGAACATGCTGGGGAGGAAGGAAGAC
ATTTCACTTATTGAGTGGCCTGATGCAGAACAGAGACCCAGCTGGTTCACTCTAGTTCGG
ACTAAAACTCACCCCTGTCTATAAGCATCAGCCTCGGCAGGATGCATTTCACATTTGTGA
TCTCATTTAACCTCCACAAAGACCCAGAAGGGTTGGTAACATTATCATACCTAGGCCTAC
TATTTTAAAAATCTAACACCCATGCAGCCCGGGCACTGAAGTGGAGGCTGGCCACGGAGA
GAGCCAGGCAATCACTGGCTTTTCCTTAGACAGAGAGCTGGTTCCTAGGAGAAGAAGCTC
CAGGCTGGGGTCCAGGCTATGACCCAACTGTTCAGTTTTGCAACATCCAGCATGGCTGCC
TGATCAGGGGTGCATATGTCAGAGGAGCCTTCAGCTGGGAAGTGCTGACAAATGACCCAG
ACCTGACCTGCCCGATGCCAAGGCCTCCTTTAGTACATCCCATGGAGGACACTTGAGACA
AAGTCACAGCTCAGCCCGTTGATTTCCCATGCTCTGACTGTGCGGTGCAGCAGGACCCCT
AGCAGGCAGCATGTGTTCAAGGCAGCGATATCCAAATGCTATGAATTGCTGTCCTGATGG
TTATTTTCCTGCATACAGTAGAGCTGATCCCTGTACAATGCTGGTCCTAAATCTCACCTT
TGACAGTGCGCTGATGTGCAATGTTTGCTTTTGTTTTATTTGATGGAACATGGCTAATTG
CTAAGAAGGTGACATGCTGCCCACTGACCACCCAATGTTCATTCTCCTCTTCTTCCTTAC
TAACAAAACTGCGGTGGTGGTGGTGAGGAGAGGGAGGGGGTATAACAAATGTGCCAAGCC
AAGAGTTTATATTTGCAAGCCTCTCTTATACCTAGAGTTGATCGTGACACAGCTCTGGCC
AATGATGTGTAAGCAGAAGTTGCTTGATGTGACTTCTGGCAAAGCTCTTAAGGAGAGGAC
TGACCTGTTTCCACATATCTTTTTCCTTTCCGTGTCCTTAGTCCTGGCTGGGATGCAGAT
GAGATGCAAAAGGTGGAGCAGCCATGTTGTCATCAGGCAGTAACAGGTCTGAGGGTAGAA
GCTGCATTCTGATAATACCAGGGAAAAATAATACAAGTAGTCTAGGGCCCAGAGATATCA
CAGATGTCCATTTGAACCCCAAATTACCTGTCTCCAGATTTGCTATCAGGCAAGAAAAGG
AAATCTTTCATTAGTTTAAGCTGTAGTTTACTCCAGTTTTCTATAACTTTCGGCCAGATA
TAACCCTAAATTGACAAAGGGGGCAAGTGCTTAACTGCAAAGCAGTTAAAACTCAAACAC
AGGCCTTCATTTCTTCAGGGTTTTAGTTTTTTCTAGGGAAGAATCTTAACTACTGCTACT
AAAAGTTATAGTAGGCCAGGGATGGTGACTCACGCCTGTAATCTCAGCACTTTGGAAGCC
CAGGCAGGTGGATCACCTGAGGTCAGGAGTTCAAGACCAGCCTGGCCAACGTGGTGAAAC
CCCATCTCTACTAAAAATACAAAAATTAGCCAGGCATGATGGTGCATGCCTGTAGTCACA
CCTACTCAGGAGGCTGAGTCAGGAGAATAGCTTGACCCAGGAGGCAGAGGTGGCAGTGAG
CCAAGATCGCACCACTGCACTCCAGCCTGGGCGACAGAGCAAGACTCTGTCTCAAAAAAA
AAAAAGTCATAATCAAAGAGGAAGACTGAGATAAATGTAGAGTCAAAGGGCTAAACAGAA
ACATAACACATGGGTTTTAAGCTAAGCCTTCACATTATCCCTTATACAATTTTATCTACA
CCGATTTCACCAAAGCTCAAAGTTATATTATTGGCTGAGATTGGCATTGGGATGGAGTGG
TGAAGCTAAGAAATTCGTTATCCCTTTGTTCCAGTGCTGCTGGACTTTTCACTAAGTGAA
GAGGTAAATGCTGAGTCTCCCAGGAGGCTGACTCCTCCTGGCTCTGGGTGTGCATTCTGA
TGAAGGTTCTTTATTGTAGGCACCAACAGAAGGCTCATGAGAGGGCAACATGGATCTCCA
TTTCTGAGCAGATGTTTAAACGCTGAATCAGGTCCAAGGCTTCCCAAATGAACTCAAGGA
GTTTCTTTTTCCCAAGCCATAGAAAGTGGCGATAGCAATCCAGGGTCTGCACTGGGAAGG
AGCACTGCCAGGACACGTCCCTCCCTGCCATTCCCCCACCCTCGCCCAGGAGACGTCCCT
CCCTGCCACCACACAGGACACATCCCTCCTTGCCATCCCACCCCCCTTCCCAGGACACGT
CCCTCCCTGCCATCCCATCCCATTCCCCCACAAGGACACGTCCCTCCCTGTCATCCCACC
CCCCTTCTCAGGACACATCCTTCCCTGCCATCCCACACCCCCCCCAGGACACGTCCCTCC
CTGCCATCCCACGCCTCCCCCCAGGACACATCCCTCCCTGCCATCCCACCCCGCCCCCCA
GGACACACAGGTCCGTGAAATCAGTATAGACACTTGTATCAAGCAAGAAGAAGCATGTTA
CTCAGAAGAACACAATTTTGTTGTTTTGTTTTTGTTTCTGGGTTTTGGTTGTTTTTTTTG
TTTTTTTTTTTGGGGAATTAAACAAATAATTTCAAGTTCTACCTCCACCACCTACCAGCT
GCATGATCTTAGACCATTGACATCACCTCCCTGACCGTGATTTTCACATCTAGAGAATGG
GAGGGGAAGAACCATGCCTTGGGGGCCAGGCTGAGGATGAACTATGAAAACCCGTCCTAT
TGGGCACTCTCGAACAGTCACCATTGTTGGTATGAGGCCCACTATCAGTGAAACTGATTG
AAATTGGTGTACATCTGAGACCTGAGGACAGCCATCAAGTGTCTATTAACTTAAGCTTTA
TGTAGCAAGCATTTATTGCACATGATCCTAGGTCCCAAGTATGCTTCGGTAAATTAAACA
CCCTTGGTCCCTGCCCTCACAAGCCGTTCATAATCTAGACAGATACATAAGATATAAATG
CACAATTGTTCATTGAAAATCTCCGAAGTCACTGGCTATTTTCTGTGGTTCTCGGCACCA
TCACCACCCTTCCAAATTCTCTCCTGTTCTCAGGGGTTAGAAACCTGCAAACTACATTCC
CTAGACTTCCTTGCCTGTAGGAGCAAAATGATCCCATGTATTACTGCGAAATGGTAGTGT
CTGGGTCCCAGAAGACAGTTAGTAGAATCAGAATGTAGGAAAGTGTGTGCCACAGCCACA
CATGTTCATGATAGTCATAACTTGTTCAGTAGGAATTTAGAGAAGACTGACTGTACACAA
GGTATTGCTAAATGCTATGCGGGATACAGAGATGCCTGTGCCTCTAAGAAACTTGGTAGA
AAAATAATAACCCACACATATTTGGCTTACCTTCTCTTTGAATAGAGCAATTGGCAGTTT
AGATTCAGTCATTCTTCAATTCATTTAGCCAAAATTTATTCTGTGATGGCTGAATCCAAC
AAATGAAGTCTCTACTCTCATATTATTTTCCATTTTGTTCCACTGAATTTCAGCAAACAT
AGACCAGACAAGCATCCCTTTGAAACCTGGACTTGGGATGAGGGTCTGCTGAGATTGGGT
TTTCTCCATGCCCAGATGCCTCTGATCAAATATCAAGTCCCAAAGATACAGATGAGAAAG
TTATTAAGTGTTCTGGGATTGGGACATCGGAGATATTAATTAACCCTGGCTTGAGATGGG
AAGAGGGGGCAGGTAGCTTTCTTTGTGTAGTGTTTAGGAAGGTGATTGCCAATCTAGGAG
AAGTGAGTTCCCCAGAGGGAGGGGGGCTCTTGGCCAGCAGGGTGACCCATATGTTCTGGT
CTGCCTGGAGCTGTGGTCCTTGGGTTCACAGCGGCCCCTTTGCACTCAAAGCACCCTAGC
TTGGACAATAAATTCTACAGTCAGTTCTGCAGTGACGATCTTCAATTCCTAGGGCTGCCA
TAAGAGAAGATCATAGACTAGGGGTGGTACACGACAGAAATTCATCTTCTCCCAGTTCTG
GAGCCTGAAAATCCAAAACAAGGTGCTGTCAGGGTTGGATTCTCCTTGGGCCTCTCTTCT
TGGCTTGCAGGTGGCTGTCTTCTGGCTGTGTCCTCGTGTGTCCCCAACATCCCCCTGTGT
GTGTGTGCAACCCTTATGTCTCTTCCTCTGCTCATAAGAAAACAGTCCTATAGGACTAGG
ACCACATTCTTATGGCCTCATTTAACCTTAATTACCTCCTTTAGGGCCCTGTCTCCAAAT
ATGTTCAGTGGAGGTTTGGGGCTTTGGCATATGAGTCTTTGGAGGCCACAGTTCTGTCCA
GAACACACTGACCCTATCCACCAGGTACTGCCACACCAATGGCTTTCAGCATTAGACAGA
GCCCCCCTGGGCTCTGTAACCCCACCCAGGGTGTTAAGAATGAGGAGTGAAAGTCCACAC
ATGTACACACATGTTAATAGCAGCATTATGCGCAACAGTCAAACAGTGGACACACCCAAA
TGCCCATCAGTGGATGATGGATACATGCAAGGTGATTTATCCAGACAGTGGCATCATATT

more info here:
http://joerg.piringer.net/codepoetry

chromosome one

the ancient roman magic square poem is the source for a treatment with the wave function collapse method.
creates a nice sound poem.

SATOR 
AREPO 
TENET 
OPERA 
ROTAS

SATOR AREPO Wave Function Collapse

electronic music, radio art, sound and visual electronic poetry, interactive collaborative systems, online communities, live performance, sound installation...


jpiringer

Pinned to spotlight

Popular tracks