tacatatatatcacatacatacatacatacatacactataca

Great write up DAVE. You have to grow...and as you do some people will like it and some won't. Stay true to yourself and as long as the music is good, people won't have much to say

Fuck eye!! 👌🔊🔊🔊🔥🔥🔥🔥. X

Lol don't forget to listen to Soulwax FM on Grand Theft Auto V xDDD

All the way from Buenos Aires, techno alchemist @ziskomusic brings a magic potion of rhythms and frequencies in this mix. Containing lots of unreleased ingredients from Zisko himself. Please have a sip.

Read our interview with him:
https://www.64crew.com/faces-zisko



<3

FACES Podcast 03 // ZISKO

T SESSIONS 150 – CRISTIAN VARELA
-
For this Halloween we have prepared a very scary and special surprise for you all, where we reach the milestone 150th podcast! And as we usually do every 50 episodes, we go the extra length to present you with a very special guest. This time we have the incredible pleasure to present you a big piece and integral part of Techno history, with a career spanning from the 90s to present day. Here is turntable wizard, producer supremo, and all round nice guy, the legend that is Cristian Varela! He supplied us with a great set, full of tension from start to finish, which we are sure you will dig as much as we did! So, please show your love with likes and comments on our Soundcloud and Youtube pages! Also, don’t forget to check our label releases, number 26 is out now on our Bandcamp shop and Beatport, and T Sessions 27 out now on Bandcamp. Links in bio.
-
https://tsessions.bandcamp.com/follow_me
-
Originally gaining DJ fame for playing standout techno sets on four vinyl turntables, many do not realise Cristian Varela is also a successful composer scoring soundtracks for film, theatre and television. He has even recorded a symphonic album at the legendary Abbey Road Studios in London.
-
Techno is always evolving and like the genre, Cristian has moved with the times. In 2018 he plans to relaunch his "Black Codes Experiments" project, which originally started in 2003 is a return to his roots with a series of gigs and vinyl only releases featuring artists such as Regis, Mark Broom, Shufflemaster, Tensal, Abstract Division, Exium and Arnaud Le Texier, amongst others.
-
When talking about Cristian Varela's roots, longstanding fans of the Techno genre will need little introduction for his seminal remixes of artists such as Ben Sims and Speedy J, and although he has spent many years leaving in London, he has never forgotten his humble roots. Often returning to Spain to give guest talks at many of the country's leading music schools and colleges.
-
More than just a remix artist, Cristian Varela has released numerous solo EP's on labels ranging from Carl Cox's Intec to his own Pornographic Recordings, and although the relaunch of his Black Codes Experiments imprint will draw some of attention from Pornographic Recordings, it will not stop the label from continuing to feature new music from the likes of The Advent, Ken Ishii, Gary Beck, Marco Bailey, UMEK, and many more.
Also planned for 2018 will be the premiere of a special documentary film celebrating Cristian Varela's 25 year career in music, which features testimonials and commentary from friends and colleagues including Carl Cox, Chris Liebing and Joseph Capriati, plus numerous others who have been instrumental in his career.
-
With a gig schedule that takes him all over the world, for those who are patient, you should be able to catch Cristian in your home city or country. For those who need a more regular dose of his music selections, you can catch his weekly radio show that's syndicated in Europe, USA, South America and Asia via more than 100 specialised techno stations in more than 50 countries.
-
Taking into account all of the above, it comes as no surprise Cristian Varela has won more than 40 awards including "Best Worldwide Techno DJ" at the DJ Awards in 2007 and again in 2013.
-
https://soundcloud.com/cristianvarela
-
https://www.instagram.com/cristianvareladj
-
Tracklist
-
Coming soon…
-
#Tsessions #CristianVarela #Spain #Techno #Hardtechno #Acidtechno #Rave #Deeptechno #Darktechno #Minimaltechno #Sound #Technopodcast #Technomusic #Vinyl #Podcast #Berlin #London #Madrid #Detroit #Worldwide #DJ #Weekly #Shows #Mixes #Sets #Clubbing

T SESSIONS 150 - CRISTIAN VARELA

The combination between worldwide gigs and high class releases on the biggest labels makes Drumcomplex from Germany one of the most requested acts at the moment. With his weekly radio show that he has been doing for 5 years and with changing well known techno acts and his own mixes he reaches a worldwide following. He delivers every week fresh underground techno in all its facets
no tracklist available

This show is syndicated & distributed exclusively by Syndicast. If you are a radio station interested in airing the show or would like to distribute your podcast / radio show please register here: https://syndicast.co.uk/distribution/registration

Drumcomplexed Radio Show 261 | Flug

V3G4 inició su interés por la música electrónica desde pequeño, influenciado por su madre y cassettes de Trance Factory con canciones como The Night Train y Fórmula 1 de DJ Visaje, además de Interstella 5555 en Canal 13.

En 2013 comenzó a escuchar dubstep y, para 2016, se enfocó en el techno y el goa trance, dando forma a un proyecto que explora emociones como la melancolía, la tristeza y la ira, a través de escalas menores y paisajes sonoros.

En 2018 inició en la producción musical, publicando sets y temas que lo llevaron a su primer podcast internacional. Desde entonces, se ha presentado en Madrid, el club Uarhaus en Tunja y, en 2023, debutó en Antisistema con dos presentaciones: una en el main y otra en el cubo.

Actualmente, V3G4 sigue desarrollando su proyecto, explorando sonidos introspectivos y energético.

Este set es bastante especial para nosotros, consideramos que es un selector increíble, esperamos lo disfruten.

Aural 018 | V3G4

Hakkon was born in Logroño, La Rioja, Spain, and is currently based in Kreuzlingen, Switzerland. He is one of the most promising emerging artists, and since 2022, he has been a proud member of the Plus One Collective in Madrid. This milestone not only fulfilled a lifelong dream but also allowed him to collaborate and share space with internationally renowned artists he has always admired.

Hakkon’s work is defined by dedication and humility. Every podcast or production he creates represents a significant achievement, fueled by passion and hard work. For him, each new project is a milestone that reflects the appreciation and support of his audience, which he values deeply.

We also want to highlight Hakkon’s strong connection to Latin America, where his audience consistently shows unwavering love and support. This fanbase has been a profound source of inspiration and a cornerstone of his artistic journey.
Hakkon’s sound is characterized by a perfect balance of emotion and energy – an invitation to a musical journey that we are proud to share with listeners worldwide.

FourkRecords Podcast_027@ HAKKON

At the age of 14, Solvados discovered his passion for electronic music and gained first DJ
experiences. Using a simple computer program, he practiced transitions and mixing beats. Three years later, he hosted his own techno radio show in Hamburg. Today, Solvados has found his own distinctive style and captivates his audience with hypnotic beats and melodic elements.

Solvados focuses on realizing his own vision and creating something unique. In 2022, he co-founded the collective and event series "Klangvision," with which he organized numerous raves in various German cities. For Solvados, music takes center stage. Besides the music, his intention is a crowd treating each other with respect and deeply enjoying the music together.

ATR - Podcast #062 - Solvados

Today we are thrilled to introduce @tinco-berlin !
Tinco is a DJ and producer of hypnotic techno who creates unique sound experiences, immersing his audience in atmospheric landscapes and hypnotic rhythms. With an innovative approach, Tinco fuses deep textures and minimalist elements, always exploring new sounds that redefine the boundaries of the genre. His artistic vision not only seeks to make you dance, but also to connect with deeper emotions and sensations, making each set and production an unforgettable journey.
Enjoy the listen!

TINCO SC : @tinco-berlin 
TINCO IG: https://www.instagram.com/tinco.alonso?igsh=dG8yNXR4cmd5N215&utm_source=qr

SNDR IG: www.instagram.com/sndr_official_/?hl=it

SNDR 050 // TINCO

FlashLab_92 DJ Mixes https://www.twitch.tv/flashlab_92
FLASH Tracks on Bandcamp https://flashrec.bandcamp.com/

Follow @flash-recordings @schottdj

[Twitch.tv/FlashLab_92] KLUBNACHT (2024.11.24) Schott

Dark Matter Pulse

BuyNow

Bashar - Going Under

January 2013's mix, bit of a mixture of stuff from last year and some new promos and tracks by myself, I had a broken turntable for a bit which explains the long gap between monthly mixes ( excuses! ), I'll try to get another mix done soon, there's loads more tunes to go in just from January alone!

This mix was also played tonight ( Jan 9th ) on the Doppler Shift show on www.fnoob.com, and represents the kind of sound I am really into right now as a DJ and as a producer. Yeah it's a bit slower, yeah it doesn't have much acid in it, yeah yeah yeah whatever, I've heard it all for so long, the complaints and the gripes from a small but very vocal group of people who just love to moan or so it seems, and lets face it this is the internet and wow! people do love to moan on the internet!. But also now I'm hearing the love and the support and for once I'm beginning to feel a bit more confident about my choice to move away from Acid Techno, the gigs are working out again playing to a slightly different crowd, maybe with a few familiar faces in there, and occasionally I'm still banging it, just for balance.

Things are beginning to come back together in the techno music world for me now, darker techno music is emerging from the minimal era with a few bruises but essentially all the more aware from the experience, the beats and BPM's have toughened up a little and the tech house influences have all but gone, also the sound is driving towards the dance floor again, so we are losing the 'swirly ambient head nodding but nothing happening' music style too, which I am happy about.

I hope 2013 is a year of great funky grooves with innovative production, less adherence to formulas, but more attention to getting people on the floor and getting them back in the clubs where they belong.

Playlist

1. Green Velvet, Harvard Bass / Lazer Beams (Original Mix)
2. Gary Beck / Before The Crash (Original Mix)
3. Axel Karakasis / Closed (Luigi Madonna Remix)
4. Redhead / False Colors (Original Mix)
5. NHB Vs Sisko Electrofanatik / My Black Line (Alex Di Stefano Remix)
6. Lowkey & Kardinal / Land Of Dust (AnGy KoRe & Tako Remix)
7. Matt Minimal / Paranormal (Original Mix)
8. Mikael Pfeiffer / Slum (Sutter Cane Remix)
9. Locomatica / Battlefield (Original Mix)
10. Spektre & Tom Laws / Psycho Diesel (Original Mix)
11. Axel Karakasis / Closed (Original Mix)
12. NHB & A.K.O. / Train Nr.5 (Original Mix)
13. AnGy KoRe / Prisoneer (Original Mix)
14. AnGy KoRe / Tavor (Original Mix)
15. Marco Bailey / Horny Tiger (Filterheadz Remix)
16. DJ Hyperactive / Wide Open (Len Faki DJ-Edit)
17. Matt Minimal / Circus (Original Mix)
18. LowKey & Kardinal / Pendular (Dave the Drummer Remix)
19. Dave the Drummer / Shard of Glass
20. Dave the Drummer / Heart of Stone





Dave The Drummer Jan 2013 Mix / Fnoob Doppler Shift radio show

D.A.V.E. The Drummer is a techno DJ and producer from the UK. He's been making electronic music since 1993 and has made dowzens of acid techno and hard techno recvords which are available on many well respected record labels.

He owns 3 record labels: 
Hydraulix Records, which concentrates on dark & hard techno.
Apex Recordings, for deeper techno & tech house
Mutate To Survive, for minimal, electro, weird tech beats.

Demos/Promos: label@hydraulix.co.uk
Linktree: https://linktr.ee/davethedrummer

Dave The Drummer Jan 2013 Mix / Fnoob Doppler Shift radio show

D.A.V.E. The Drummer

Recent comments

WeeTee😘

McKennaii

AprendizdeTeo

DJ Torsion

Related tracks